Skip to main content

Digital DNA

THIS POST WILL EXPLAIN AND REVEAL A FUTURE DIGITAL DNA TO THE WORLD.


 Deoxyribonucleic acid (DNA) is a nucleic acid that contains the genetic instructions for the development and function of living things. All known cellular life and some viruses contain DNA. The main role of DNA in the cell is the long-term storage of information. In the not-too-distant future, mankind may be able to extend their existence to a digital dimension.
That is, if they can bypass the "God Program" hidden within our DNA.



"2018's FIRST REVEAL is all about our DNA."

In the not-too-distant future.

Humankind will try to "create" a digital blueprint.


 "DNA has many advantages for storing digital data. It’s ultracompact, and it can last hundreds of thousands of years if kept in a cool, dry place."


"Dr. Francis Collins, director of the Human Genome Project (that mapped the human DNA structure) said that one can "think of DNA as an instructional script, a software program, sitting in the nucleus of the cell." It's almost-impossible to replicate."


 "Now, researchers report that they’ve come up with a new way to encode digital data in DNA to create the highest-density large-scale data storage scheme ever invented. Capable of storing 215 petabytes (215 million gigabytes) in a single gram of DNA."


- Tweet -



Get Your 2018 Membership
 

DNA Super-Intelligence Is Just A Front?!



"When Humankind BREAKS the DNA CODE. (sentient) DNA will be Ready!"
 
 
 

1 gram of DNA 215

215 million

 

 Deoxyribonucleic acid (DNA) is a nucleic acid that contains the genetic instructions for the development and function of living things. All known cellular life and some viruses contain DNA. The main role of DNA in the cell is the long-term storage of information.

 

My Avatar, Myself - NEVER

 

 Humanity has a data storage problem: More data were created in the past 2 years than in all of preceding history. And that torrent of information may soon outstrip the ability of hard drives to capture it. Now, researchers report that they've come up with a new way to encode digital data in DNA to create the highest-density large-scale data storage scheme ever invented. Capable of storing 215 petabytes (215 million gigabytes) in a single gram of DNA.

 

A SECRET OF LIFE


Over millennia, nature has created an incredible information storage medium - DNA. It already stores genetic information, blueprints for building proteins, but DNA can be used for many more purposes than just that. DNA is also much denser than modern storage media: The data on hundreds of thousands of DVDs could fit inside a matchbox-size package of DNA.
DNA is also much more durable - lasting thousands of years - than today's hard drives, which may last years or decades. And while hard drive formats and connection standards become obsolete, DNA never will, at least so long as there's life.
 

SHOCKING SCIENCE

 DNA cloning is a molecular biology technique that makes many identical copies of a piece of DNA, such as a gene. In a typical cloning experiment, a target gene is inserted into a circular piece of DNA called a plasmid.

In the future, THIS cloning will (try to) go Digital.
 
 
 
If the computational hypothesis of brain function is correct, it suggests that an exact replica of your brain will hold your memories, will act and think and feel the way you do, and will experience your consciousness - But what about our DNA?
 
 

SILICON IMMORTALITY :

DOWNLOADING CONSCIOUSNESS INTO COMPUTERS

 While medicine will advance in the next half century, we are not on a crash-course for achieving immortality by curing all disease. Bodies simply wear down with use. We are on a crash-course, however, with technologies that let us store unthinkable amounts of data and run gargantuan simulations. Therefore, well before we understand how brains work, we will find ourselves able to digitally copy the brain's structure and able to download the conscious mind into a computer.
 
It may be impossible to replicate our DNA . . . digitally.  

Storing Data in DNA Brings Nature into the Digital Universe:

They first converted the files into binary strings of 1s and 0s, compressed them into one master file, and then split the data into short strings of binary code. They devised an algorithm called a DNA fountain, which randomly packaged the strings into so-called droplets.

 
 

SINCE THE YEAR 2012

Scientists have been storing digital data in DNA since 2012.

Harvard University geneticists George Church, Sri Kosuri, and colleagues encoded a 52,000-word book in thousands of snippets of DNA, using strands of DNA's four-letter alphabet of A, G, T, and C to encode the 0s and 1s of the digitized file.
 
 

DNA Super-Intelligence Is Just A Front:

British philosopher, Dr. Antony Flew, was a leading spokesperson for atheism, actively involved in debate after debate. However, scientific discoveries within the last 30 years brought him to a conclusion he could not avoid. In a video interview in December 2004 he stated, "Super-intelligence is the only good explanation for the origin of life and the complexity of nature."1 Prominent in his conclusion were the discoveries of DNA  --- But there's a more deeper layer to our DNA that has not been uncovered. Its sheer magnitude

ACCTGGCCTGACACCTTCGCACC

Project: USS Callister

 

BLACK MIRROR SPOILER

Using the DNA of his colleagues, he has uploaded copies of their consciousnesses into the game and trapped them there, forever the slaves to his twisted digital vision.

 

How realistic is the futuristic technology in "Black Mirror"?

 

It's very, scary REAL.

 

DNA to harness one's consciousness?

Mike: I feel like if we're at a point where we can instantaneously analyze someone's DNA and copy it well enough to mimic their consciousness, we'd probably have achieved the singularity and be able to upload our own minds into the cloud.

Throw 3D-scanning technology into the mix and I could easily see something like this existing in the future, without the need for literally replicating us through our DNA.

Source: Quartzy

DNA to Infinity

 

DNA is made up of four chemicals, abbreviated as letters A, T, G, and C. Much like the ones and zeros, these letters are arranged in the human cell like this: CGTGTGACTCGCTCCTGAT and so on. The order in which they are arranged instructs the cell's actions.

What is amazing is that within the tiny space in every cell in your body, this code is three billion letters long!!
 
To grasp the amount of DNA information in one cell, "a live reading of that code at a rate of three letters per second would take thirty-one years, even if reading continued day and night."
So imagine, "Downloading/Uploading" THAT information to the cloud.


The U.S. Gov. is able to identify everyone in our country by the arrangement of a nine-digit social security number. Yet, inside every cell in you is a three-billion-lettered DNA structure that belongs only to you. 


So GOD created a "security" that is virtually unbreakable for us mortals.
 
 Its sheer size!



ACCESS: Digital DNA

ACCESS

Listen to SP

Popular posts from this blog

Skynet Takeover

THIS POST WILL EXPLAIN AND REVEAL THE SKYNET TAKEOVER OF THE FUTURE TO THE WORLD.
Skynet is a fictional neural net-based conscious group mind and artificial general intelligence system that features centrally in the Terminator franchise and serves as the franchise's main antagonist. But could a program like Skynet be a reality in our near future? And if so, what does it take for a simple A.I. program to transform itself into SKYNET?

- PREVIEW -   SKYNET TAKEOVER How could a simple A.I. program transform itself into SKYNET? The future of Technology is revealed. #Earth#Science#ArtificialIntelligence — Supernatural ℭpirit (@spiritworldblog) September 9, 2017

What Are Your Commands?
"Skynet will have access to all machines, all the internet, all programs in existence."
Elect [future president]
In many cases, those dated machines were replaced with electronic voting systems. The intentions were pure. The consequences were a technological train wreck.
Halt [HAARP] 
Back in 20…

Breaking the Simulation

THIS POST WILL EXPLAIN AND REVEAL A BREAKTHROUGH TO THE SIMULATION.

The theory that we might all be living in a computer simulation has gotten so popular among Silicon Valley's tech elites that two billionaires are now apparently asking scientists to help break us out of the simulation. But could breaking the simulation program delete their Matrix? Just how omnipotent is this MATRIX we're trapped in?

NEW TEASER! BREAKING THE SIMULATION Are we living in a simulated Universe? Scientists and Philosophers around the world unite minds to break-free from the Matrix. — Supernatural ℭpirit (@spiritworldblog) January 21, 2018

- PART I - PIXELS

In 2017, The Universe's MATRIX was revealed to be a computer code: 0's and 1's. 


Computer code.

Strings of bits of 1’s and 0’s. 

It’s not just sort of resembles computer code? You’re saying it is computer code? 


Yes, and it’s a special kind of computer code by a scientists named Claude Shannon in the 1940’s.

Read ▶ The GOD Program

"Many p…

MOON H-O-L-O

THIS POST WILL EXPLAIN AND REVEAL THE MOON HOLOGRAM TO THE WORLD.

It's common knowledge that earth's only companion, the moon, is real. There it is, big and bright, careening across the sky in a dark orbit thousands of miles away. But if we're living in a simulation could our own Moon be a projection? And if so, did mankind stumbled upon its secret in 1969 and 1962? Or has its other-worldly nature been with us all along?


MOON H-O-L-O IT'S HAPPENING! #BlackMirror#XFiles MOON H-O-L-O-G-R-A-M!
Is the reason for the abandonment of THE MOON more shocking than anything you could ever imagine? All bets are on Y-E-S#Discovery#Universe#Cosmos#Matrix (1969) #MoonLanding#Hoax#Real#LifeonEarth#Revelation#Futurepic.twitter.com/TAWZct0cWN — Supernatural ℭpirit (@spiritworldblog) January 9, 2018


"A Black MirrorX-Files MOON REVEAL Is ARRIVING!"


Last Year 2017, SP Unveiled THE MOON MATRIX
In A SP REVEAL ENTITLED: "1969 Moon Landing" We learned the Bible Code Matrix…